
Improve Your PCR Performance with PCRboost. Simply.
  • Enhance your most challenging PCR samples
  • Simple to Use
  • Reduces number of cycles
  • Use existing Taq polymerase and PCR protocol
PCRboost Image

Enhance PCR Performance for Difficult Samples

PCRboost is a unique reagent that enhances end-point and reverse transcription-PCR performance by improving sensitivity and specificity during amplification of genomic DNA or RNA templates. To use, simply replace the water in your PCR with PCRboost. That's all. It is designed to enhance the amplification of DNA without the need for time consuming optimizations. PCRboost successfully amplifies thermally degraded DNA resulting in a visible amplicon that can be used for downstream applications such as cloning and sequencing.


Product Performance

Successful amplification of thermally degraded DNA using PCRboost

PCRboost gels

Figure 1: Genomic DNA (gDNA) from human blood was purified using the QIAamp® DNA Blood Mini Kit., and 500ng was exposed to 70°C for 20h. 1 µl (~50ng) of thermally degraded DNA or control DNA stored at 4°C was used as template for PCR reactions. The reactions were set up using 2.5 U Taq DNA polymerase (NEB), 3μl 10x thermopol reaction buffer (NEB), 0.5µl dNTPs (10µM each nucleotide), 0.5µl each of human β-actin forward and reverse primers. The volume in the thermally degraded DNA PCR reaction tubes was brought up either in water or in PCRboost. Following PCR amplification, 10µl of each PCR reaction was run on an agarose gel. A) 500ng human genomic DNA stored at 4°C and thermally degraded at 70°C for 20h run on an agarose gel. L: 1kb ladder. B) 50ng of cold-stored (4°C) and thermally degraded DNA used as template in PCR reactions amplifying the human β-actin gene. PCR reactions were brought up to volume either in water or PCRboost. L: ladder.

Serial Dilution Using PCRboost

Agarose gel image showing results of decreasing concentration of PCRboost
Figure-2: 50ng human genomic DNA (gDNA) was amplified by PCR using 2.5 U Taq DNA polymerase (NEB), 3µl 10x thermopol reaction buffer (NEB), 0.5 µl dNTPs (10µM each nucleotide), 0.5 µl each human β-actin forward(5’ctacctcatgaagatcctcacc3’) and β-actin reverse (5’gtacttgcgctcaggaggagc3’;10µM each) in a final volume of 30 µl. The PCRboost volume was serially diluted and replaced by water*. Cycling parameters were: 94°C for 5 min followed by 40 cycles of 94°C for 15 sec, 55°C for 30 sec and 72°C for 30 sec. 10 µl of each PCR reactions was run on a 0.8% agarose/ethidium bromide gel.

Identical Reactions in Water Versus PCRboost

Agarose gel image of identical PCR reactions in water versus PCRboost
Figure-3:100, 50, 20, 10 or 4 ng gDNA was used in PCR reactions where the reaction was brought up to volume in either water or PCRboost. Samples were used to amplify the fibroblast growth factor 13 (FGF13) gene by PCR using 2.5 U Taq DNA polymerase (NEB), 3µl 10x thermopol reaction buffer (NEB), 0.5 µl dNTPs (10µM each nucleotide), FGF13 forward (5’gaatgttaacaacatgctggc3’) and FGF13 reverse (5’agaagctttaccaatgttttcca3’) (kind gift of Dr. D. Cohn) in a final volume of 30 µl*. Cycling parameters were: 94°C for 5 min followed by 40 cycles of 94°C for 15 sec, 55°C for 30 sec and 72°C for 30 sec. 10 µl of each PCR reaction was run on a 0.8% agarose/ethidium bromide gel.

Comparison of PCRboost to Other PCR Enhancers

Agarose gel image showing PCR results of PCRboost compared to three other PCR enhancers from different companies
Figure-4:PCR enhancers from 3 different companies were tested alongside PCRboost and compared to a non-enhanced water control* using 1 ng gDNA (conditions used were the same as Figure 2 above).

Use of PCRboost with Three Different Taq Polymerases

Agarose gel image showing PCR results of PCRboost used with Taq polymerase from three different companies
Figure-5:Taq DNA polymerases from 3 different suppliers were tested alongside PCRboost using 10 ng gDNA* (conditions used were the same as Figure 2 above).

Testing of PCRboost in RT-PCR

Agarose gel image showing RT-PCR results of PCRboost used with Taq polymerase from three different companies
Figure-6: RT-PCR reactions were set up using the gene specific reverse primer for the single-copy RNase P gene (5’agaccatcctggctaacacg3’). Small amounts of total RNA (100ng) extracted from 293 cells (human adenocarcinoma cell line) were used for first strand cDNA generation using manufacturer’s instructions for the AffinityScript™ (Stratagene/Agilent Technologies) RT-PCR kit. Reactions were set up using either water or replacing the water component with PCRboost. 1µl of the cDNA was then used in a subsequent second strand PCR reaction using forward (5’ttcactgcttcatgcctacg3’) and reverse primers for the RNase P gene (conditions used were the same in Figure 2 above). Reactions were set up using either water or replacing the water component with PCRboost.


* PCR reactions were set up using cocktails of common elements.

Product Specifications

Product Formats 1 mL
Storage time 6 months
Storage Temperature 15 - 25 °C
Downstream Applications plasmid purification, bacterial propagation, glycerol stock preparation

For a limited time, order online & get a 5% discount. Use promo code: DISC5


Catalog No. Product Description Size Price
63301-011 PCRboost® 1 mL $250.00

Buy DNAgard Saliva